METABLE2 Genes

PROKKA_00033 Rhodococcus

GenomeRhodococcus ctg_1:34922-35875
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00033 hypothetical protein
ATGGACGGTGGCGATACGCTGACCTCGATGACGCCGCTATCTCCGGTCGACGAAGTCACG
GTGACTTCTCAGCGACCACTCGATGCCGCGCTGACGCTCAGCCCGCATCAGCGCGGACCC
GGCGACCCCGCACATCGGCGGTCCGCCGACGGAGCGATCTGGCGAGTTTCCCGCCAACTT
TCGGGTCCTGTGACCTACCGCATCACTCAGTCGGATCGCCACTCGGTGCGGGTGCAGGCG
TGGGGTCCCGGCGCCACGGAATTACTGATCGGCGCTGAAGCGTTGCTCGGTCTCGACGAC
GAAGCCGAAGATTTCGCCCCCGAACATCCCAAGCTCGCCGAAGCTCATCGACGCTTCCCG
CATCTGCGCATCGGCCGCACCGGCCGCGTCATGGAAGCTCTCGTTCCCGCGATCCTCGAG
CAACGCGTCCACGGCATCGACGCGTTTGCCGCGTGGCGCCGCCTGCTGACCAAGTTCGGT
GAGCGCCCGCCCGGCCCGGCACCCGACGGAATGCGAGTTCCACTCACCGCGGACCAATGG
CGTCGAATGCCGTCATGGGAGTTCCATCGCGCGAACGTCGATCCCGCGAGGTCCAAGACG
ATCGTTCAGTGTGCTCGCGTCGCCGACCGCCTCGAGCAGGCGTCATCGTTCCCCAGGGCC
GAAGCGACCAAACGATTGCGAGCGGTGCCCGGCGTCGGGATCTGGACTGCCGCGGAAGTG
GCTCAGCGCGCCTTCGGCGATTCCGATGCACTCTCGGTCGGCGACTACCACCTCGCTGCC
GTCGTCGGGTGGTCACTGCTGGGTGAACCGATAGACGACGCCGAGATGGTGGAGTACCTC
GCGCCCCTTCAACCGCATCGATACCGCGCCGTGAGGCTTCTGCAGGTCAGCGGCCAAGCC
GTCAAACCCAAGTTCGGTCCGCGAACTGCCGTTGCCGACCACCGCTGGCACTGA