METABLE2 Genes

PROKKA_00036 Rhodococcus

GenomeRhodococcus ctg_1:37556-38689
ProductCDS NADH oxidase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P32382
Sequence
>PROKKA_00036 NADH oxidase
GTGACCAACCCGCTGTTCCAACCGCTCCGTATCCGTTCGCTCGAATTGTCCAACCGCATA
GTCATGTCGCCGATGACGCGCACGTACTCCATCGAGGGCGTGCCCGGGCGCGACGTCGCC
GACTACTACCGCCGACGCGCCGAGGGCGGGACCGGACTGATCGTCACCGAGGGCGTCGCG
ATCGATCACGAGACTGCTGTCGATCACGCCAATGTCCCCAACCTCCACACCCCTGCCGCT
CAGGCCGGCTGGCGCAAGGTAGTCGACGACGTGCACGCTGCGGGCGGCAAGATCGTGCCT
CAGCTGTGGCACGTCGGACCGCTGTGGGGTGCGATGACGCAAATGGACCCCTCACTCAAG
CCGATGCGCCCCTCCGGCGAATGGGGCCCGCTCGGCGTCACCTCGTACTCTGCTGCCTAC
GTCGAGCGCGCACAGGCGAGCACCGAAGCGATGACCGAGCAGGACATCCAGGACGTCATC
GACGCGTACGTCCGCAGCGCGAAGCACGCCGTCGAACTCGGCTTCGACGGAATCGCGATC
CACGGCGGTCACGGCTACCTCCTCGACTCCTTCTTCTGGGAGGGCACCAACCAGCGCGAC
GACGCGTGGGGCGGCGACCTGGAGCGTCGTACCAAGTTCCCGGCCGCCGTCGTCGCTGCG
ATCCGTGCGGCCATCGGACCGGATCTGCCGATCATCTACCGTTTCTCGCAGCACAAGCAG
CAGGATTTCACCGCCAAGATCGCGGAAACTCCCGAGGAGTTGGGCGTCATCCTGGGCGCG
CTGGTCGACGCCGGAGTCGACGTTCTCGACGCCAGCATCAGGCGTTTCGACGTCCCGGCC
TTCGAAGGCAGCGATCTCTCGCTAGCGGGTTGGGCGAAGAAGCTGACCGGCGCTGTCACG
ATGGCGGTCGGCAGCGTCGGCATCGGAAAGTCGCTGCGGGACAGCCGCATCGAAGGCGTT
GCGCCGGTGGTGGACAACATCCCACAGCTCGAGGAGCGCATCGGCAGCGGTGAGTTCGAT
CTGATCGCGATCGGCCGCCTCCATCTCGCCGATCCGGCGTTGGCGTCGACCCTGCGCGAC
GGTGGTCCGCTGCCCGCGTTCGATCGAGCCGTGCATGAGGGCAGCTTGATCTAG