METABLE2 Genes

PROKKA_00038 Rhodococcus

GenomeRhodococcus ctg_1:39269-40252
ProductCDS Amidohydrolase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF04909.8
Sequence
>PROKKA_00038 Amidohydrolase
ATGGCGGGCCGTCAACGACCTGTCCCGGTGAGCGCGACGGCGCTCGGTATGGTCGAGCGA
ACGAAAGGGGTGTCAGACGTGTGTACCGAAGAGGTCCCATCGACCGGACCGGAAGAGATC
GCCGAGGTTCGGGCTTTCTGGCGCGAGTTGGGTGTTCCGGGCGTGATCGACGTCCATACC
CATTTCATGCCGAAGAGCGTCATGGACAAGGTGTGGGGTTACTTCGATTCGGCGGGCCCG
ATGATCGGGCGACCATGGCCCATCGCCTACCGCCTTGCCGAGGAGGAACGGGTACACCGT
CTCCGCGAGTTCGGCGTCCGAGCTTTCACGTCCATGATCTACCCGCACAAGCACGCGATG
GCCGAGTGGCTCAACCAGTGGGCCGTCGAGTTTGCCGCGCAAACACCCGATTGCCTGCAC
ACGGCCACTTTCTATCCCGAGGAGTCGGCAGCGTCGTACGTCGGGAAGGCGTTGGAGTCG
GGTGCGCGAATCTTCAAGTCCCACATCCAGGTCGGCAACTACGATCCGAACGACCCTCTG
CTCGAAAAGGTCTGGGGTCAGCTCGAGGACTCCGAGACGCCTATCGTGATCCACTGTGGA
TCGGGACCGGCGCCGGGGGAGTACACGGGGCCCGATCGCATTGCTTCGCTGTTGTCACGG
TACCCGCGCCTGTCGTTGATCGTCGCGCACATGGGGATGCCCGAGTACAGCGAATTCCTC
GATCTGGCAGAGGCTTACGGCAACATTCGCCTGGATACGACCATGGCCTTCACCGACTTC
ACGGAAGAGCAGTGTGCCTTCCCGAAGGCCGACGTGTCACGGCTCGTCGACATGCAGGAC
CGCATCCTGTTCGGCAGCGACTTCCCCAACATCCCGTACCCGTATCTCACGGCCTTGCAA
GCGGTTACGCGCTTCGATCTCGGAGACGAGTGGCTGCGAGCCGTCGTGCACGACAACGCT
GCCAAGCTCTTCTCGGTGAGCTGA