METABLE2 Genes

PROKKA_00040 Rhodococcus

GenomeRhodococcus ctg_1:41047-41985
ProductCDS Putative short-chain type dehydrogenase/reductase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P96825
Sequence
>PROKKA_00040 Putative short-chain type dehydrogenase/reductase
ATGACGCAATCACTGAGCTTGGAAGGCAAAGTTGCCGCCGTCACCGGCGCCGGCGCCGGC
CTGGGTCGCGCCGAGGCACTCGGACTCGCCGCTGCCGGCGCAGCCGTCATCGTCAACGAC
ATGGGCGCAGCGGCCAACGACGTGGTCGACGAGATCAAGGCAGCAGGCGGACAGGCACTC
GCCATCACCGGCGACGTCTCCGATTGGTCACTCGGCGGGCGCATCATCGAAGAGGCCGTC
AAGAACTTCGGATCCTTCGACATCCTCGTCAACAATGCAGGCATCCTGCGCGACAAGATG
ATCTTCAACCTGACCGAATCCGATTGGGACGACGTCATCCGCGTACACCTCAAGGGTCAC
GCCGCCACCTCACACGCAGCCGCAGTCCACTGGCGCGCAGCCAGCAAGGCCGCCGACGCA
CCGGTCTACGGCCGCATCATCAATACCTCTTCCGAAGCCTTTCTCTTCGGCAGCGCCGGA
CAGCCCAACTACTCGGCAGCCAAGGCCGGTATCACCGCGCTGACGCTCTCGAGCGCAGCA
GGTCTCTCCCGCTACGGCGTCCGCACCAACGCGATCTGCCCCCGCGCCCGCACCGCCATG
ACGGCAGAAGCCTTCGGCGAGAACAACACCGGCGTCGCCGGCCTCGATCCGCTTGCACCC
GAGCGCGTCGCTACCCTGGTCAGCTACCTCGCATCCCCCGATTCCGACGAGATCAACGGT
CAGGTATTCGTCGTCTACGGCAAGATGGTGGCGTTGATGGAAGCACCCAAGGTCGAGAAT
CGTTTCGACGCAGCCGGATCCGCGTTCACGGTCGAAGAACTCGGTGGCCAGCTCTCGTCC
TACTTCTCCGGCCGTGGGCCGTACGAGACCTACGCCGCCTACAGCGTCGCCGGCCTCGAA
AAGATCGCACTTGCAGTCGACGAGACCGCAACAGTTTAA