METABLE2 Genes

PROKKA_00041 Rhodococcus

GenomeRhodococcus ctg_1:42261-42404
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00041 hypothetical protein
ATGGTTGTCGACACCCAGAAACGTCCCCATCCCACACCGCCGTCGGAGATCCTCACGGCG
GGATCGGCTTTCGCGACTTCTGGTGGCGCAACGGGTGAATCCGCCCAGTTCTTGGCCGCA
TTCGTCGGCACCAGGGTCGGATAG