METABLE2 Genes

PROKKA_00042 Rhodococcus

GenomeRhodococcus ctg_1:42473-44068
ProductCDS Long-chain-fatty-acid--CoA ligase FadD19
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q7D5D8
Sequence
>PROKKA_00042 Long-chain-fatty-acid--CoA ligase FadD19
GTGTCACTGAATTTGGCAGATCTGTACGAGGGCATTTCGGATTTGATTCCGGACCGCACG
GCACTCGTGTGCGATGGCCGTCGTCGCACCTACGTCGAACTGGACGAGGGATCGAACCGC
ATTGCCCGCCACTTGGCGAGTGTCGGTGTCGGGCCGGGCGATCACGTCGCTCTGCACATG
CGCAACAGCATCGAGTTCGTCGAGAGTTTGCTCGGCTGCCTCAAGATTCGCGCAGTCCCG
ATCAACGTCAACTATCGCTACGTCGACGCCGAACTGACCTACCTGTACAACGATTCGCAG
TCGGTAGCGCTGATCGTGGACGAGGAGTTCGTTCCCGTCGTGGAGACTGTCCTCCCGGCC
GCGCCCGGAATCAAACACGTCGTTGTCGTCGGCGAGTCTGTGGTCCGCGACATCGAAGGC
GTCGACGTCGTTCGATATGCCGACGCTGCCGCGGAGCAGTCCGCTACTCGTGACTTCGCG
CCCCGCAGCAACGACGACCTCTTCGTCATCTACACCGGTGGCACGACGGGTATGCCCAAG
GGGGTCATGTGGCGTCACGAGGACTTCTACTTCGCGGCGCTCACCGGCGGAAATCCGTTC
GGTCCGCCGCACACCACCGCTGAAGCTCTGTACGCCGCGGTCCCGAACGTGCCCGCGATG
AACATGCTCAGCACTGCACCGTTGATGCACGGCGCAGCGTCGTACTCGCTGTTCACCGGA
TTCTTCATGGGCGCCAACGCAATTCTCATGGCGCGCTTCGACGCGAAGACGACCCTGCAG
CTCGCCGGGAGTGAGAAGGCCGTCTCCATCACCGTCGTCGGAGATGCGATGGCGCGTCCG
CTCGCAGACGAATTGGCTGCCAACGCTGCGGATTACGATCTCAGCACGGTCGGAATGGTC
TCGTCGGGCGGAGCATTGTTCTCGCTCTCCCTGCGCGAGCAGCTCAAGTCCATACTCCCG
AACCTGGTGATCCGCGACGGATTCGGCTCCTCGGAGTCGGGCGTCGACGGCAATCTCGAG
ATCGGCGAAGACGGCTTGATGCGCATCGCGGCTCGCGACGAGACCCGCGTCGTGGACGAA
AGGATGCGGCCGCTGGAGCCGGGATCTCCCGAGACCGGGTACATCGCTCGCAGTGGTCAC
GTGCCGGTCGGCTATTTCAATGATCCGGTCAAGACCGCGGCTACGTTCCCGGTGATCGAC
GGGGTGCGGATGTCGGTGCTCGGCGACGTCGGACGTGTCGAAGCCGACGGCTCGATCGTC
CTGCTGGGGCGTGGTTCTCAGTGCATCAACACCGGTGGGGAGAAGGTGTATCCCGAGGAG
GTCGAGCAGGCACTCAAGAGTCACCCGGCTGTGCTCGACGCTCTGGTCGCGGGAATTCCG
GATGCGAAGTTCGGTGAGCGCGTCGCGGCGGTCATCACGACCCGCGAAGGCTTCGACGTC
CCGGACGCTGCCGAGATCGGTGAGCATTGCGCGTCGCAGGTCGCTCGGTACAAAGTGCCG
CGCACCGTCATGAACGTTCCGTCGATCAGGCGTTCTCCCAGCGGAAAGGCCGATTACCGC
TGGGCAAAGGCCACTCTCGCCGAGCAAGCCTCCTAG