METABLE2 Genes

PROKKA_00044 Rhodococcus

GenomeRhodococcus ctg_1:45501-45992
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00044 hypothetical protein
ATGACCGACACGACCGCCCTGATCGAATCTCTGCTGGCCCGAGTGGAATTGCTCGAGGAC
AAACTCGCGATCACCGAACTGCTGACCACCTACAGCCCTGCCGTCGACAGTGGATCAGCC
GACGAGGTCGCGAACCTGTGGCTCGAGGACGGCGTCTACGACGTCGACACCGGCGCGATG
CACGGCCGCGGCGAACTCCGGGCCATGGTTCACAGCGCCTCTCACCAGAACTGGATCATG
AACGGCGCGGCCCACATGATGACGCCAGCGCACATCCGCATCGACGGCAACAAGGCCGTC
GCGACCTGCCATTCGCAATTGGTCATCAAGGACCCAGAGAACCCGACGGGGTTCAAGGTC
CTCCGTATCACCGCGAACCGCTGGGAACTGATCAAGACGGACGGCGAGTGGAAGGTCGAA
CTGCGTACCAACGCCCTCCTCGACGGACGGCCCGAGGCCCGCGCTCTCCTGGCCGCCGGG
GTGACGGCCTAA