METABLE2 Genes

PROKKA_00051 Rhodococcus

GenomeRhodococcus ctg_1:52569-53084
ProductCDS OsmC-like protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02566.13
Sequence
>PROKKA_00051 OsmC-like protein
ATGACCACCGCTTCCATCTCACACCTGAGTTCCGTCGTAGCAGCCAACGCCGACGCCATC
GACAAGGACGCGAGCAAAGCGCACGTCGTCTTCAAGGCTTCCGCCCAGGCGCACGACGCC
GTTGCCAGCACCATTTCTCTCGGTAAGTACAGCGTCGAGGTCGACGAGCCGCCGGCCCTC
GGCGGCGAGAACACCGCAGCCAATCCTGTCGAGTACTACCTTGCTTCGCTTCTGTCGTGC
CAGGTGGTCACCTACCGCGTCTGGGCCGACAAGCTCGGTATCGCTCTCGACGACATCTCG
GCCAGAGCCGAAGGTGACCTCGACGTTCGTGGATTCTTCGGCTTCGACGACGCCGTCCGT
CCGGGATTCTCCGAGGTACGCGTGGTCGTCACCCTGACCGGCCCGGAAACCCGCGAACGG
TATCTGGAGCTGCAGGAGACGGTCGACGCCCACTGCCCCGTACTCGATCTCACCCGCAAT
CCCGTCCCAGTGCATACAGTCGTCGAAACCGCCTGA