METABLE2 Genes

PROKKA_00056 Rhodococcus

GenomeRhodococcus ctg_1:56591-57712
ProductCDS Saccharopine dehydrogenase
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF03435.12
Sequence
>PROKKA_00056 Saccharopine dehydrogenase
ATGTCCGAAAAGAAGCCAGTCATCGTCTACGGCGTCTCCGGGTACACCGGTCGCCTGGTG
TGTGAATACCTGCGCGAGTTCAACATCCCGTTCATCGCAGCCGGCCGAGACGCCGCTCGC
ATTCAAGAGGTACTCGACAAGATCCCCGGTTTGGACACCGTCGATCACGAGGTCGTCGAG
GTCGAGCACACTGTCGAGGCGCTCACCGAATTGTTCACCGGTGCACAGGTTGTCAGTAAC
ATGGTCGGGCCGTTCATCAAGCTTGGCGGCACCGTCGTGGAGGCCACGTTGAATGCCGGT
TGCCACTACATGGACACCACCGGTGAGCAGGACTGGGTACTCGACGTCCAGGAGAAGTTC
AGCGACAAGTACCAGGAGAAGGGCCTGCTTCTCTCACCCGGCATCGCGCAGATGTACACC
ACCGGTGAGATCGCGGCCAACATCACACTGGAAACGCCGGGCCTCGATACGCTCGACATT
CTGGTGCTGTGGAAGGGATTCCCCACTTACGCCTCCACTCAGACGATCTTCACCATCCTC
AAGGCGAACTGGTACTACCTCGAGCAGAACAAGTACGTGCAGTGGGCGCCCGGTCAGACT
TTCGACGTCGTCGTTCCCGGCCAGCACGAAACCGCGCTGGCATTGCCGTGGGGCGGAACG
TGTCACCCGGTGTGGTTCAAGAACGATCCGCGAGTTTCCAACGTCAAGGCTGCGGGCGGT
GTCTTCGACCGCACCGTGATGGAAGGTGTTGTCGCGACACAGAAGATCGTGGAGGAGCAG
ATCAAAACCCTGCCTGCCGACGAGCAGGAAGCCGCCCTGGCCGAGATCGCCGGTTCGGTG
CAGGCTGGTATGCCGCCTCGTGAGAATCCGCGTATCAACACCTCATTGGACTCCGTCTAC
GCGTCGGGCCCGCTCGGTCGCTCGCACGTCGTGATCCACGGCAACTGCAACTACAAGCAG
ACGGGCCTACTGCATGCATATGCAGCACATTCGCTGCTTCAGCAGGCGCCCAAGCGGACC
GGGCTTGCCTCGGCTTGCCAGGCGTTCGGCCATCGCGAACTGCTCGGCGCGCTACGTAGT
TTCGGGCTGGCGCTGGAACCGGAAGTAACCATCAACGCCTAG