METABLE2 Genes

PROKKA_00059 Rhodococcus

GenomeRhodococcus ctg_1:61028-61570
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00059 hypothetical protein
GTGAGTAGATACTTCGGGCCTTTGCGCCAATTGGGTTTTGTGGTCAACGACATCGACAGC
GCGCTGAAGCATTGGATCGACGTTGTCGGCGTAGGCCCCTTCTTCTTCGTGGAGGACCAA
CCGTTGAACGACTTCGTCTTCCGTGGCAAGTCGAGTGCGCCTCGATTCAGTGTGGCGCTC
GCGCACAGCGGAAGTGCGCAGATCGAGCTGATTCAACAACACAACGATGAGCCGTCGGCA
TTTCGCGAGTTCGCAGATCGCGGGCTCGAAGGACTTCAACATGTTGCCTACTGGACAACG
GATTTCGATCGACATATGGAGGAATCCAAGAACCGAGGGCTTGTCGAATTGCAGAGTGGT
AGGTCCGGTAGTGGCGCTCCGGACGAGCGATTCGTGTACTACGAGGACGGCCCGTATCCG
GGAACAGTCATCGAAATCTCGGAGGTCAGGGGAAGGAAGGGTGATCTGTTTCGCGCAGTC
GAGGCTGCATCGAAGGAGTGGGACGGGTCGAATCCCATTCGCGACATGAGGAAGGTGCTG
TAG