METABLE2 Genes

PROKKA_00062 Rhodococcus

GenomeRhodococcus ctg_1:63234-63662
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00062 hypothetical protein
ATGCGAGTAGTTGAAACCGAAGGTGCCGAACCTACTTTGGTTCATTCCTCTAACGGAAAG
AGAGTGTGGATCATGGATTCGATTGCGTTTGCTTCTTCGGCTCAGGCCGGTGATGTGATC
GTGACCGGATCACACGGAGGGACGAGTGCTGGAGAGTACGCCGTCGGGTTCGGGGTTCGT
GTTGTGGTGTGCAATGACGCCGGCATAGGGAAGAACAAGGCCGGAATCGCAGGCTTGGCT
GCGATCGATGCCCAGAAGATCGTCGGCATTGCAGTCGGACACGAGAGTTCGCGTATCGGA
GATGGCAACGACGTGTGGGAGTGCGGCATCGTGACGTATGCCAATCCGACTGCGGTCGCA
GCGGGTGTGCGTGTGGGCAGCCGCGTTTCCGAAGAAGTGCTGGCACTGATAGAGAGGAGC
GTCGACTGA