METABLE2 Genes

PROKKA_00063 Rhodococcus

GenomeRhodococcus ctg_1:63662-64096
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00063 hypothetical protein
ATGTTTCGGAACATTGTCGGTGTGGAGAACGGTAGACAGATTGTCGTCATGGACAGTATG
TCGCAGATCGAACGGTCGGACCGCGACCGCATCGTCGTTGCGGCATCCAACGGCGGTCAA
GAGTCAGGGCGGATGGCGATTGCGACGGGCTGTGCGTTGGCTGTGCTGAACGATGCCGGA
ATCGGCAAGGATAACGCAGGGATCATCGGAATCGTCCGCATGGGAGATGCGGGACTTGCC
GGCGTAGCGGTCAGTCACGACTCTGCCGAAATCAGCAATGGAATGGATATGTGGCACAAC
GGAACTGTCTCCTACGTCAACGAACCCGCGGCGTCGGCTGGGATACGGGTCGGTGACAAT
GTTCGCACGTGTGTGAGTGCGTTCGCGGTTTGCTTCCCTGTCGGTCCAATGTCGGCGTCC
GAGAGTTCGTCATGA