METABLE2 Genes

PROKKA_00068 Rhodococcus

GenomeRhodococcus ctg_1:68350-68520
ProductCDS gluconate 5-dehydrogenase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK06124
Sequence
>PROKKA_00068 gluconate 5-dehydrogenase
GTGACAATCACTGAGCGTGTCGGCCGAGTCGTGGTCGTGACCGGTGCAGGGTCGGGACTC
GGCCGCGCAATGGCCAGAGGTCTACTCGACGCCGGACACCACGTTGTATTGGCTGGTCGA
AACAGCGTGAGCTTGGAGGGACAGGTGGGGGTCACGAGCGTGCAGTGGTAA