METABLE2 Genes

PROKKA_00075 Rhodococcus

GenomeRhodococcus ctg_1:73658-74788
ProductCDS FtsX-like permease family protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF02687.15
Sequence
>PROKKA_00075 FtsX-like permease family protein
ATGTTCCTCGCCCTGCGTGAACTGTGGTTTGCGCGAAATCGATTCCTCTTGATGGGTGCC
GTGGTTGCCCTCATCGCGATCCTGATGGTGATCCTGTCCGGGCTCTCGTCCGGCCTGGTC
AACGATGGTGTCTCCGCGTTGCAGCGGACACCGATCCAGGCATTCGCCTTCGCTCCGGAC
ACGAAGGCAGACTCTGCGTTTTCACGGTCGGTCGTCACCGAAGAGCAGGCGCAGGCATGG
CGCGCGCAACCGGATGTCCAAGACGCCGAACTGTTCGGAAACATGATCGTCAATGCAAAA
ACTCGCAGTGGCACTCCCGTCGATCTCACTCTTTTCGGCATCGAACCGGGCTCGTTCCTC
GAACCCGTCCCTGCCGAGGGGAGGGCTTTGCTCGCTGACACCGACATCATCGTCAGCTCC
ACCTTCCGTGACGACGGTGTCTCGATCGGTGACACCGTGATACTCGACCGACTCGGCACC
GAGCTGACAGTGGTCGGATTCACCGAAGACAAACGCACTTTCGGACACGTCGACGTCGCC
TACCTGCCCTTGCATACCTGGCAGGAGGTACACGCCGGCGCCAAGATCGGCGAAACTGTC
AACGCCAGTGCGTATTCCGAGGCAAGTGTTGTGGCAATCCGAGGCAAGGGCGATGCGTTG
CCGGACCTCGCATCGGGAGATGCGGCGGCGGGAACGTCTGCCAAGACGCTCGAGGACTCT
TTCGACTCGTCGCCGGGTTTCTCCGCGGAAATGATGACGATGTCGATGATCAAGGCGTTT
CTGTACGCGATCTCCGCGCTGGTTGTCGGCGCATTCTTCAGTATCTGGACTGTTCAGCGC
GGTCGTGAACTCGCAGTGTTGCGTGCGATGGGTGCTTCCACCGGTTTCCTGCTCCGCGAC
GGATTGGCGCAGGCATTGGTGGTGCTGCTCGGCTCCATCGGTGTTGGCGTCGTACTCGGA
TTGGGTCTCGGCTCGGGACTCGAAGGTGGAGGAATGCCGTTCGCCCTCGAGTCCGGTCCG
ATCGTCAACGGCGCTGCGCTCTTGGCGGTACTCGGGCTGATGGGCGCAGCCGTTGCCATC
GTCCGCATCACCCGTGTCAACCCGCTCACCGCGCTGGGAGAAAACCGATGA