METABLE2 Genes

PROKKA_00077 Rhodococcus

GenomeRhodococcus ctg_1:75499-76050
ProductCDS transcriptional regulator BetI
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK00767
Sequence
>PROKKA_00077 transcriptional regulator BetI
GTGCCGAGGATCGATGCCCCCACTGTGGCCGAGCATCGCGCTGCTCAGCGCCGTTCTCTC
CTCGACGCTGCACACGCTCTTCTGTCCGAGACCCCGGACCGGCCGCCGGGGCTCGGTGAG
GTTGCAGCGAAGGCCGGGCTCGCCAGGTCGAGTGCCTACCACTATTTCCGGTCCCGAGAG
GATCTCCTCAGCGCTGTCGTCGAAGACATGTTCCCGCGCTGGAACGACAAGATCGTCGAG
GCGATGGCACGCGCCGACGATCCGGTATGGGCGTACGTCGAAGCAAATCTGCAATTGGTT
GCCGACGGGGAGCATGCGATAGTCGGAGCGCTGGCGACGCTGACCCCGCAAACGTTTCGA
GATTCGCGGATCATGGAAATGCACGACAGTCTTGTGCTTCCTCTGGTCGAGGCACTCCGT
CTCCGCGGTGTGTCGGACCCCAAGCTCACCGCGAAGTTGATCAACTCGCTCGTGCATACG
GGTACAGAACTGATCGAATCCGGTTGCAGCATGGACGAAGTCAGGTCCGCCGTGCGCGAG
GTCCTCGCGTGA