METABLE2 Genes

PROKKA_00078 Rhodococcus

GenomeRhodococcus ctg_1:76060-76434
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00078 hypothetical protein
ATGCCGATGCCGAGATGGTGGGGACACGTCAACAAGCGAGTGTTCAATCCGCGAGCGATC
TCGAGCGGGAAGTGGCCGGTACTGACACACGTCGGACGCACATCCGGGACGACCTATCGG
ACCCCTCTCGACGCCTATCCGGTCGAGGGTGGCTATGTCTTCATTCTGGTGTACGGATCG
GGCTCGGACTGGGTGCAGAACGTCTTGAAAGCGGGGAGCGCTCGACTGTCGGTCGACGAG
ACGGAGGTGAGCCTCGGCGCCCCGCGCCTCGTCGCGAAAGACGAAGCATTTCAAGCACTT
TCCTCAGACGTGTCCCAACCCCCGAGGATGCTCCGCATCACCGAGTATCTCCGGATGGAT
CTGATCACGGCTTGA