METABLE2 Genes

PROKKA_00083 Rhodococcus

GenomeRhodococcus ctg_1:81143-82579
ProductCDS allantoin permease
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK11375
Sequence
>PROKKA_00083 allantoin permease
ATGACTCACGATGGACCGGCCGAGGTCATCCTCACTCCGGAACGACGCACTATCGACGTC
GTCCCGGATGCAGAACGACACGGCACCCCGCGCAGCCAGTTCACTCTCTGGTTCGGCGCC
AACATGCAGATCACTGCAATCGTCGACGGTGCTCTCGCCGTCGTATTCGGCGCGGACGCC
ATCTGGGCGATCGTCGGACTTCTGATCGGCAACATCTTCGGTGGCGCTGTCATGGCGCTT
CACTCCGCACAGGGTCCGCGCATGGGCCTCCCCCAGATGATCTCGAGTCGCGCCCAGTTC
GGCGTCAAGGGAGCCGTCGTCCCGCTTGTTCTGGTCATCCTGATGTACCTCGGCTTCGCT
GCCACGGGCACCGTGTTGGCCGGCCAAGCCGTCAACAAGATCCTGCACATCGACAGCCCC
ACCGTCGGCATCGTCGTCTTCGGTCTCCTCACCGCATTCGTCGCGGTCACCGGCTACAAG
CTGATCCACATCGTCGGCAGAATCGCCACCGTCGTGGGCATCGTCGGATTCTCCTACCTG
GCCGTTCGACTGTTCCTCGAGTACGACGTCGCCTCATACGTCGGCATCAAGGGCTTCGAC
ATCGTCACCTTCCTGCTCGCGATCTCGCTGGGTGCCGGTTGGCAGCTCACCTTCGGCCCG
TACGTCGCCGATTACTCGCGTTACCTGCCGCGCAGCACCTCCGAGAGCACCACGTTCTGG
TCGACGTTCCTCGGTAGCGTCATCGGATCACAGTGGTCCATGACCTTCGGCGCTCTCGTC
GCGGCCTGCGCCGGCGACGCGTTCCTGGGTAACCAGGTCGGCTTCATGGGAGATCTCGCC
GGACCCGCTGCCATCGCCTTCCTGATCTACTTCGTCATCCTGGTCGGCAAGCTGACGGTG
AACGTGCTCAACGCGTACGGCGGATTCATGTCGATCCTGACCACCGTCACAGCCTTCAAC
GGCCAGTCGCGAATCTCCAGCACCGCGCGCACCCTCTACATCCTCGGTTTCACCGCCGTC
TCGGTGTTGATCGCGATCGCCGCCAGCGCCGACTTCCTGGACAACTTCAAGAACTTCGTC
CTGGTATTGCTGATGGTGTTCACTCCGTGGAGTGCGATCAATCTGATCGACTACTACTTG
ATCTCCAAGGAGCGCATCGACATTCCGGCGCTCTACGACGTCAACGGTCGGTACGGAGCC
TGGAACTTCACTGCCCTGGCCTGCTACGCCGCCGGTGTTCTCGCCCAGATCCCGTTCCTC
GCCCAAAAGATGTACACCGGCCCCGTCACGGACATGCTCGGCGGCGCCGACATCTCGTGG
CTCGTCGGCATCGTCTTCACCGGCCTGATCTATTACCCGCTCGCCAAGCGCACCAGTAAT
CCGCCTGCGTCGATGATCTACCCCGATCACACCGCGATGACCGACTCTCGCGTCTGA