METABLE2 Genes

PROKKA_00084 Rhodococcus

GenomeRhodococcus ctg_1:82782-84146
ProductCDS putative FAD-linked oxidoreductase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q50685
Sequence
>PROKKA_00084 putative FAD-linked oxidoreductase
ATGTCCGTCCACGAACTTGCTCGGTCGATCGGTTCGAGTCGCCTGATCACCGACCCGGCG
GTAATGGACTCGTACCGTCGCGACGAGGCCCATCTCGCCGAACCCGGCCATCCGGTAGCC
GTCATGCTCGCCGAAACTGCGGCCGACATTTCCGAGGCTCTGAAATGGTCTACCGCTCAC
CGTGTCCCGGTGGTAACCCGCGGTGCAGGAACCGGTTTGGCGGGCGGCGGGACGGCCGTC
GAGGGCTGCCTGGTCATCTCGACCACTCGCATGCGCTCGATTCTCGAGGTCAATCCGGAC
GATCAGCTCGCTGTCGTGGAAGCCGGGGTGATCAACGCCGACATCAGTCGAGCAGCAGAC
GAGTACGGGCTGATGTACGCCCCGGATCCGAGCAGTTTCGAGATCTCCACGATCGGCGGG
AACATCGCCACCAACGCCGGTGGACTTCGATGCGTGAAGTACGGCGTCACCCGCGATTCA
GTCTTGGGCCTCGAGGTGGTACTCGCTGACGGGCGGATCGTGCGAACGGGTCGAAGGACC
GTCAAAGGTGTTGCGGGATACGACCTGACGAGCCTTCTCGTCGGTTCGGAAGGAACTCTC
GGAGTCGTCACGAGCGCCACACTCAAACTCCAGCCCAAACCCAAGAGAGCACCGGTCACC
GTCGTCGGCAGTTTCGATTCTCTCCGCTCTGCGGCGGACGCAGTTGCCGCGGTCGTTCGT
GACGGGATCGGGCCGAGCCTGCTCGAACTGATCGATCGAGCAACCCTTCGCGCAGTCGAC
GACTGGAAACGAATCGGGTTGGAAGACAATACTGCCGCGATGCTGATCGCGCAGGCCGAC
GGGGTCGATGCCGACGCAGCAGCGGCGGCGATGCAGAAACACTTCGAACAGGCCGGCGCC
GATTTTGTCGCCGTCTCGCAGGATGCAGCGGAAGCCGCACAACTACTCGAGATCCGCAGG
CTCGCCTACCCGGCGTCCGAACGTCTTGGGCAATGCCTCGTGGAAGACGTCGGGGTCCCA
CGGTCGAAACTGCCCGACATGCTCGAAAGTATCGACCGGGCCGCTGCCGAGCATTCGGTG
AAGATCATGACGGTCGCCCATGCGGGTGACGGCAACGTCCACCCGACGTTCGTATTCGAC
CGCACCGAAGACGGCTCGGTCCCCGAAGCCGTGTGGACCGCCGCGGACGAGGTCTTCCGA
CATGCCCTCGAACTCGGCGGAACTCTCACCGGAGAGCACGGCGTCGGCGTCTTGAAGCGT
CGCTGGCTCTCTCTCGAACTCGGCGAGGACAGCATGCAACTGCACCGATCGATCAAGGCC
GCGTTCGATCCGCTCGGAATCCTCAACCCGGGTAAGGGTTTCTGA