METABLE2 Genes

PROKKA_00093 Rhodococcus

GenomeRhodococcus ctg_1:96806-98200
ProductCDS D-alanyl-D-alanine carboxypeptidase precursor
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P15555
Sequence
>PROKKA_00093 D-alanyl-D-alanine carboxypeptidase precursor
GTGACCGACTTGCCCAAGGACCTACTTGTCGCCCCGAAGTGGCAGGAACGCCTCGACGAA
CTGGCAGCCAAGCATTCGGTACCGGGCGCGCAGGTCGGTGTGATCGCGCTGGGCGAAGAC
GGCGCAGCGGATATCCGTGTCATCACCACCGGAGTGACGAGCCTGAACACACGAGTCGAC
GTCGATGCCGACACCCTGTTCCAGTTCGGATCCGCGAGCAAGATCTGGACGACGACGCTG
ATCATGCAGCTCGTCGACGAGGGCAAGCTGACGCTGGACACCTTGGTGGTGGAGGTGCTT
CCGGAGTTCACGATCGCGGATCCTTCCAACACGAAGGAAATCACGATTCGCCAGTTGCTC
ACGCACACAAGCGGTATCGACGGAGACCTGTTCAACGACACTGGTGACGGCGACGACTGC
GTCGAGAAGTACGTCGACGAACTCGCGACCGCGATCAGCGTCACCGAGCCCGGCGGACAT
CTGAGTTACAGCAACGCGGGTTTCGCCGTGGCCGGCCGTATCGTCGAGGTTCTTCGTGAG
ATGACGTGGGACGAGGCGTTGGTCGAATACCTCTGGAAGCCACTCGGATTGACGCACATC
ATCACCAAGGCCAAGGACGCCCCTCTGTTCCGCACCGCCGTCGGCCATGTGGCCAACCCG
GATCGGACGTCGCCGGACAAGGTGGTTCCGACCAAGCAGTGGCTGCTTCCGCGCGGTATC
GGTCCGGCCGGCATCATCACCGGATCCGTCAGCTCTCTGCTGACATTCGGTGCTGCACAC
ATGCGAGACGGCCTGGCTCTGACGGGTGAGCGCATTCTGTCCGAAGAGTCCGCGCGCCTG
ATGCGCACTCCGCAATTCGACCTGACCGCGGTCTCGAGCGTCGATCAGGCCTGGGGTCTC
GGCTGGATCCTGTCCGACTGGGGCGGTGTGACGTCCGCGCAGCATGGCGGTGCGACGATC
GGTCAGATCACTCGTTTTCACACCTTCCCCGAGCTCGGTCTCGCCATGGCCGTAGTCACA
AACTCGCGTGGCGGCGGTGCCCTGGCCCACGACATCGAGAAGGAGATCGCGCAGGAGCTC
GATCTCGTTCTGCCGGAGCCGAAGTCCGAGCCGAATGCAGAAGACATCGACCTGTCGCAC
ATTCTCGGAACCTATGAATCGACAACCGTTCGCATCGAACTCACGCGTGGCGACGACGGC
GGATTCCAGGTGCAGAACTTCGCCAAGATCGAGATCGACGGCGAGCCGCCCGCCCCGCCC
ACCAAGGTCGTGCCTCTGTCCGCTTCCCGGTTCTCGATCAGTAACGAGAGCGCTTCGGGT
GAGATGGCTCATCTCACGATCGATGGCGAGGAATATCTGTACATGACAAGGCTTTTCAAG
AAGATTTCCGACTAG