METABLE2 Genes

PROKKA_00094 Rhodococcus

GenomeRhodococcus ctg_1:98254-99378
ProductCDS Membrane dipeptidase (Peptidase family M19)
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF01244.15
Sequence
>PROKKA_00094 Membrane dipeptidase (Peptidase family M19)
ATGAGGGCCCTCGACCTGCCCGCACTACTTTCCCGAGGAAAACTCATGTTGAAACCTCTC
GCTCCTTTCCCGGACGTGAATCACCCAGCGGCACTGGATGCTTACGGCCTTGCACCGGTC
ATCGACGGCCACAACGATCTCGCATGGACAGCTCGCGAGACTGCCGACTACTCGGTGGAG
AATCTCGAGAAGGATTCCATCTTCCAAACCGACATCGACAAACTCGGTCGCGGTGGCGTC
GGTGCGCAGTTCTGGTCGGTTTACACCCCGTGTGACCGGACGGAGGCCGAGGCTGTTCAG
TACACACTCGAACAGATCGACTTCGTGTACCGGTTGATCGAGCGGTACCCGGATACTTTC
GAATTCGCGCGTACAGGTGACGACGTGCGTCGCATCTGGAGCGAGGGCAAGGTTGCGTCA
TTGTTAGGCGCAGAGGGCGGTCACAGCATCGGCAGTTCGCTCGGCGTCCTGAGAATGATG
GCGCGCCTTGGTCTTCGGTACATGACGCTGACGCACAACGACAACACCGGGTGGGCGGAC
TCCGCGACGGACACCCGAGTGCACGGCGGGCTGACCGACTTCGGCCGCGAGATCGTGCGC
GAAATGAACCGGCTCGGCGTGCTCGTCGACCTGTCGCACGTCTCGGTGGAAACGATGAGA
GATGCCATCGAGACGTCGTCGGCACCGGTGATCTTCAGCCATTCGTCCTGCTCTCAGCTG
TGCGGTCACCCCCGCAACGTTCCCGACGACGTCATGCGGCTGCTCGCGGCAAACGGCGGG
GTCATCATGATCGCCTTTGTGCCTATGTTCCTTTCTGCCGAGTACAACGAGTGGTTCAAA
GGCGGGCGGGTCGGCCCACGGCCGGCGATGACGGTGGACCATCTGGCCGATCATGTCGAG
CATGCCCGAGACGTCGCGGGCATCGACCACATCGGTTTGGGTAGTGACTACGATGGATTC
GACGACTTTCCGGACGGTATGCAGGACGTATCCGGTTTCGCGGTGTTGATAGACCGTCTG
GCGGAACGCGGTTGGCCTGCGGAGGACTTGGCAAAGCTGATGGGCAACAACGTGTTGCGT
GTGCTCGACGAGACCAGTGTGGCCTCGATGTCGAGCCTTTCCTAG