METABLE2 Genes

PROKKA_00095 Rhodococcus

GenomeRhodococcus ctg_1:99411-100346
ProductCDS haloalkane dehalogenase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK03592
Sequence
>PROKKA_00095 haloalkane dehalogenase
ATGAAGAAGATTCGTACCGTTGCACTGAAGGTTCTTGCGTCGGTGTCCGTAGTTCTGGTT
GTGCTGGTATCGATAGCGCTCGTATTCGATGTCGGCTCCGCCAAGGCGAGCGTTCCGACC
GGGGAAACCGGCAACCAGTTCGTGTCCGTAGACGGAAAGAACATGAGCTACTCGATCCGC
GGCAACGGCGATCAGACCATCGTTCTGCTGCCCGGATTCGGAACGTCTGCACCGATTCTC
GACTTCACGCCGCTCGTCAACGAGCTGGCACCTGACTACCGCGTAGTCACGATCGAGCCC
TTCGGATACGGGCACAGCGACGGAACGGACAAGGATCGCACGACGGCGAACATCGTCGAG
GAGGTACACGAGGCTGTGCAGTCTCTGGGGATCGACCAATACATCCTCATGGGTCACTCG
ATCACCGGTGTCTATGCACTGGACTACACGGCGAAGTACCGCGACGAGGTCACCGCTTTC
GTGGGAATCGACAGTAGTGTTCCGGGTCAGCCGAATATGGATACCAAATTCCCGATCGAA
GCACTCCGAGTTGGAAGGCAATTGGGCTTGGCGGAATTGCTCTCCAAGTTCGTCGGCGGT
GAAACCTCGGACGAGTACCTCGACGCCGCAGCAAAGGACGAGATGCGACAGTTGACTGCG
AAGAACAACTTCAGCGACACCTATCTCAACGAGATGGATCATCTTTCCAGCAACTTCGCA
GAAGCAATCGGCAGGACATTCCCGGCTGATCTTCCGATTCTGTTGTTCGCCGTGCAGAAC
TCAGAAGTCGAGGGCTGGACTGCGCTGCACGAAGGACAGGCAGCATCGGTCGATCATGGT
GAATTGGTCTTGCTGGACGGAGATCACTACCTGCACCACACCAAGTCGAAAGAGATCGCC
GAGAACGTCAACAGGTTCATGGGAGAACTGAACTAG