METABLE2 Genes

PROKKA_00096 Rhodococcus

GenomeRhodococcus ctg_1:100432-100938
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00096 hypothetical protein
GTGGCGCAGACCTTGTCACGCGAGGAACTGGCGAGTGAGCTGGACACGGCGTATTCGAAA
CTCGACGCGTTACTCGAGAGCGCCGCCGAGGCCGATGTTTTCGACGTCGTTGCCGTCGAT
GCGTGGACGGTGCACGACGTACTCGCTGTGCGTGTCTGGTGGGCAGAGGCCGTCGTAGAG
TGGATAGGTGCCGGACTGCGAGACCAGACTCCGCAGACGCCGGCGGCGGGTTACAAGTGG
ACGCAAACACCCGCGCTGAATCAGTCGGTGGTCGAGGCGAGTGCAGGTACCTCGGTTCGA
GAGCTTCGGGATCGTTTGGGCGCGGCTGTCGCAGCGCTGCGTCGATACGTGGAAACTCTC
GACGAGGATCAACTGCTGTCGGTCGGGGTTTTCTCGTGGACCAGGACCTGGCCGGTGTCG
AGGTGGATCGCAGTCAACACGATCACCCAATACGCGTCCTTGTCGAAAATGATTCGGCGA
GTGCTGAAGTCGAACAATCAGTCCTGA