METABLE2 Genes

PROKKA_00097 Rhodococcus

GenomeRhodococcus ctg_1:100929-101507
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00097 hypothetical protein
ATGCAGAATTCTGTTCGACCGCTGTCCATCAACGACCTCGACCGTGCCGCCGAGGTTCTC
GGCGAGGCGTTTGCCGACTACCCCTGGACGAACTGGTGCGTCGCCGAAGACTCCCACGTG
GAACGCGTCGCGGCTCTGCAACGGATCTACCTCGAACACCTGGCACTACCGTTCGGGCGT
TCCTACATCGACGATTCCGGCAACGGCGTCATCGCAGTCCTGCCGCCCGACGCCCCGGAG
CCAGATGAAGCGACCGTCGAGAAGATCGTCGAACTGCACGGAGATCGGTTCGAGCGCGTT
CTTCAGGCTGACGAACAACTGTCTGCGCTTCCCGTCCCCGACAACGCATGGTCGTTGGCA
ACGATCGGTACGACGCTGCGCTCACGCGGAACCGGATTGGGTTCTGCGCTACTGAAACAT
GCTTTGGCGGAGCTGGATCGAACTGAACAGGATTGCTGGCTCGATACGTCAACCGAACGA
AATCTACCGCTGTACCAACGGTTCGGTTTCACGATCGTCGGCCAGGCCTCGCTCCCCAAC
GGACCAAACGTATGGCGGATGCATCGACTTCAGGACTGA