METABLE2 Genes

PROKKA_00098 Rhodococcus

GenomeRhodococcus ctg_1:101722-102516
ProductCDS NADP-dependent 7-alpha-hydroxysteroid dehydrogenase
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:P50200
Sequence
>PROKKA_00098 NADP-dependent 7-alpha-hydroxysteroid dehydrogenase
ATGAACAGGCTCGAAGGCAAGAAGGTAGTGATCACCGGCGCCGCCAGTGGAATCGGGCGT
GCCGCAGCACAACTCATGGCGGCAGAAGGTGCCGCGGTGCTGGTTGCCGACCTCGATCCG
GCGCGAGCAGAGGAAGCGGCGGTGGCGATTCGCGAGACCGGTGGCACTGCACTGGGTTTC
GGCGTCGACGTCATGAACGAGGACTCCCTGGCCGCGATGATCGAAAAGGCGGTCGCCGAA
TTCGGCGGCATCAACGTCTTGTGCAATCACGTGGGCGGTAGCAATCCGCGCAAAGATCTC
GACCTGCTCCGGATGGACCTGGACGAGTGGGATCGCGTGATGTCCCTCAACGTGCGCAGC
ACTGTCGTCGCTTCACGCCTTGCCATTCCGCACATGAACAGCGGCGGCGGAGGGTCGATC
GTCAACACGGCCTCGGTCGGTGGATTGATCGGAGACTCCCTGCAGTCGGCCTATGGGTCT
GCCAAGGCGGCGGTCATCCGGTTGACTCAATACATTGCAGTTCAGTACGGAGCAAACGGT
GTTCGGTGCAACGCCGTAGCGCCGGGTGCGATCATGACACCCGCACTCGTGGACAACATC
CCTGCTGACGTCATCGAAGGCATGAAGCAGGCCAACGCCCTGCCTTACCTCGGCGAACCC
GAAGACATCGCACACGCCATGGTCTACCTGGCGTCGGATGAATCTCGCTACATGACGGGG
CAGACCTTGGTGGTCGACGGCGGACTCACCAGCAAGAGTCCACTCGCGACCGGCCGTTCG
TCGGTGTTGAGCTGA