METABLE2 Genes

PROKKA_00099 Rhodococcus

GenomeRhodococcus ctg_1:102518-102976
ProductCDS SnoaL-like domain protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF12680.1
Sequence
>PROKKA_00099 SnoaL-like domain protein
ATGAGCGTCGACATCACCACCCTTCTCGACGAACGTGAGATCACCCGCTCCATCTTCGAG
TTCGCCCGAGCCATGGATGCGCGGGACTGGGATGAACTCCACCGGATCATGACGCCGGAC
GCTACGGCGGAACTGGGAACCGGAACTCTGTGCGGACCTGCCGAGGTAGTGGCTTCCATC
CGCTCGTTCCTCGACGAGTGCGGTCCGACCCAACATCTGATCGGCAACGTGCTGGTCGAG
GTGGTCGGCGATCTCGCCACCAGCCGCTCCTACGTCAGTGACATGCACGTGGGCACCGGG
AGCAAAGCTCACCTGAACTTCTTCACGCTCGGCGACTACCACGATTCGTGGTCGCGAATC
GACGGAACGTGGCGAATGACGCACCGCACCAAGCATTCACACGCCAGTCAGGGATCCATC
GAGGTTCTGGGAGCCGGCCCCAACGGTTGGCGGAGCTGA