METABLE2 Genes

PROKKA_00101 Rhodococcus

GenomeRhodococcus ctg_1:103847-104143
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00101 hypothetical protein
ATGCAGCCTCTTCAGTGCGCTGAGTGCAAGGCGCAGGTCCTGGTCCAGAAGAACAGTTGG
GAACACACCACCGTTCAGTGGAGTGACCAGGCCCGCGCCCAGTGCCTCGAAATCGCCGAC
GACCGTGAATTCGGGCAGCGAGAGGGGCGACCCGGTGCTCCTCGCAAGGAGTGCGGCGCC
TTGATCGCATCCATCGTGAATGCTGCAACAGCGGGCGAGCTCGAGATCCTCAACGACGAG
CCGGTGCCCAAGCCGATCGTCGACGACAGCGAACCCGTACCGGCTCCGTTTCACTAG