METABLE2 Genes

PROKKA_00106 Rhodococcus

GenomeRhodococcus ctg_1:108437-108898
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF08327.5
Sequence
>PROKKA_00106 hypothetical protein
ATGAGTGACCAGAATGCCGATGCCACTGCAGAATTCACCATCACCCGGATCTTCGACGCG
CCGCGCGACCTTGTCTGGCAAGCGTGGACCGATCCCGACGAGGCGGCGCGTTGGTGGCAC
CCTGAGGGTGTCAGCAGCCCTCGGGAGCACGTCACGATCGATCCCAGAGTTGGCGGAACG
TACCGCTACCTGATGATCAACGACGAGAATGGTGCCGAGTTCCCCACCGGCGGAACCTAT
CTCGAGGTCGACGAGCCGAAGAAACTGGTCTTCACCTGGGGGAATCCAGGAGATTCGGTG
GATACTGCGCCGCGAATCACGGTCACGCTCGCAGATCGGGGCGACAAGACCGAGATGACA
TTCCATCTGGTCGGGGTCCCGGGTTTCAAGGGCGACGGCAACGTCTACGACGGGTGGGAA
TCCGCGTTCGACGTGCTGGACCAGGTGTACCGCGGCGAGTAG