METABLE2 Genes

PROKKA_00107 Rhodococcus

GenomeRhodococcus ctg_1:108981-109859
ProductCDS Lactonase drp35
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:Q7A338
Sequence
>PROKKA_00107 Lactonase drp35
ATGGCACCAGAGGTTGCGGTAGTTCTCGAGGGTTATACCTACATCGAATGCCCACGCTGG
CACGAAAACCGGGTTTGGGTGTCGGACTTCTATACCTATCAGGTGATTTCGGCCCGCGAG
GACGGGACCGACATACGCGTGGAGGCGGAGGTTCCAGGGCAACCGTCGGGGCTGGGGTGG
CTTCCGGACGGCAGATTGCTGGTGGTCTCCATGCGGGACCAGAAGATTCTGCGGCGAGAA
TCCGACGGCGAGTTGGTGGTGCACGCGGACTTGTCCGAGTACGTCAGTGCCAACGTCAAC
GACATGCTGGTCGATGCGCAGGGACGAGCGTACGTAGGCAACTTCGGGTTCGACCTGATG
AACCTGGCTCCCGTCGAAACGGCAGATCTCCTCCGCGTCGACCCGGACGGATCGGTACAC
GTCGTGGCGCGAGATCTCCACTTCCCCAACGGTATGGCTCTGACGTCGACCGGAGATCTG
CTCGTGGACGAAACGCTGGGAAATCGAATCAGTGCGTTTGCGGTCCAGGCCGACGGCTCC
CTGAGCGAACGCCGTGATTGGGCGTCGTTCGGGCCGGTACCTGGTGGACCCGAGATGGAG
ACCACTCTCGCTCAGATCGTCGTTGCGCCCGACGGATGCTGCATCGACGGAGACGATTCG
ATGTGGGTGGCCGACGCCCTCGGAAGTCGTGTTCTTCATGTGAGCGCCGGCAAGATAATC
GATGAAATTGCCTTCGGCAGCGGTGTCTTCGCGTGCGGGCTCGGCGGCTCCGACGGACGT
ACGCTGTTCGTCTGCGCCGCACCGGACTTCAACGAGCACGCTCGTAAGGTCGCCAACGAA
GGAAAGCTGTTGTCGATTCGCCTGGAGCCGTTGGGCTGA