METABLE2 Genes

PROKKA_00108 Rhodococcus

GenomeRhodococcus ctg_1:109861-110874
ProductCDS methylenetetrahydromethanopterin reductase
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK02271
Sequence
>PROKKA_00108 methylenetetrahydromethanopterin reductase
ATGGAATTGGTGACCTCGCTACCTGCCGACACTCCGCTGCGGCAGGTAGCTCAGCACGTC
GAACGCATCGAGAAACTCGGTTTCGACACGGTGCACATCTCCGAGACCGTCCGCGATCCG
TTTGCGGTGGCAGCACTCGCCGTCGAACACAGCACCACCCTCACCGTCCGGACGTCGATG
GTTGTCGCATTTGCGCGCAGTCCCATGGTGACGGCTTTGGCTGCGTGGGATCTGGCGGAC
TTCTCCGGTGGACGATTCCAATTGGGGCTTGCGACGCAGGTGCGGGGTAACATCGTCGGA
CGGTATTCGATGCCGTGGACAGATCCTGTTGCGCAACTGCGTGATTACGTCGGCGCTGTG
CGTGAGATATTTCGAGTGTTCCAAACGGGCGGCAAACTCGACTATGCCGGTTCGCACTAC
ACTTTCAACAGGCTGCAACCCTATTTCAGCCCGGGGCAGATCGGTGTTCCGGCTCCGGAG
ATCTGGACCGGGGGAGTGAACTCACGGATGTGCTCCCTCGCGGGCGACGTCGCCGATGGA
TTTGTGGCTCACCCCACCAGCTCGCATCCGAAGGTGCTCGCGGAGAGGATCATTCCGTCA
TTGACGGGCGGTGGGAGGAAGCCGAGACTGATTGCCGTTCCGAAGACGATCACCGGCAAA
GATCGGGCCGCGATCATCGCGCAGCGAGAAGCGGCGCGCAGCGAACTCGCCTTTCTCTAC
TCCACTCCGGCGTACCGAGTCGCGCTGGAGGTCCTCGGATTGTCCGAGATCGGGGAGGAG
CTGACGGTGATGGCGCGGGCAGGTGATTGGGCCCAGCTACCTGCCGTCCTCACCGACGAT
GTTCTCGACATCTTGGTCACACAATGCACTTATGCGGAACTCCCCGACGTGGTGAGTTCG
AAGTACGTGGGCCTCTGCGACGGGATTGCACTGTCGGTGCCGACGGATCCTGCAGACGAC
GGTGCCTTCACGGCGATGTGTGAGGAGCTTCGAGGTGCAGCGTCGGCCGAATGA