METABLE2 Genes

PROKKA_00109 Rhodococcus

GenomeRhodococcus ctg_1:111068-112978
ProductCDS Metallo-beta-lactamase superfamily protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF00753.21
Sequence
>PROKKA_00109 Metallo-beta-lactamase superfamily protein
ATGGGTGCTGAGACCAAGCCTGCAACGCCGTTCACGGTCGAGGTCAACCGCGCGGCAGTA
GACGACTATCCGATGTCGGACCGAGCAGATTTCGGCGATGCCGACCGCGGATTCATCGCC
GGGTGGGACAACGACCAGGTCTTCAACGACAACGGCGATTTGATCCACGACGGTCAACCG
CTCGAATACATCGGCGATGACAAACAGGCTCCGGAGACGGTAAACCCGAGTTTGTGGAGG
CAGTCGCAGTTGGTGAGGCGCTGTGGGCTCTACAAGGTGGTCGACGGTCTGTACCAGGTC
AGGTTCGCAGTAAACCTCACCATCGTCGACGCTCCCGACGGACTCGTCATCATCGACACC
ACCACCAGTGCCGATCTCGCCAAGGCGGGCCTGGAGTTGTTCCGTCGTGAACTGGGCAAC
AACAAGCCTGTCGTCGCGATCATCTACACCCACACGCATTTCGACCACTACGCCGGAGTC
AAGGGTCTCGTCGACGAGGCAGACGTGGTTTCGGGCAAGATCCCGATCGTCGCGCCCGGA
ACCATCGAGTCGTTCAACAAGTTCGCGATCGGTGAAAACGTCATCACCGGCAATGCGATG
TCGCGACGCATGGGGTATACCTTCGGTTTGATTCTGCCGCAATGTGATTGCGGTCTGGTG
ACAGTTGGTCTGGGTTCGGGTGCCGACAACATGAACATTCACATGACCTACATGCCGCCC
ACCGACGGCATCACCAAGACCGGTGAGGTGCGCAACCTCGGTGGGTGGGACTTCGAGTTC
CTGTACGCCCCGGACACCGAGGCGCCGGAGGAGATGCACATCTGGATTCCCGCCATCAAG
GCACTCACCTGTGCCGAGAACGCCAATCACTCGATGCACAACATCCAGACGATCCGTGGT
GCGCGCACGCGAGATGCACGAAATTTCGCGCGGTACCTGGACGAGACATTGGTGCGGTGG
GGCGACGACGTGGAAGCGCACCACGGCCCGCACACGTGGCCGGTGTGGGGGAACGCCACG
GTAGTGGAATTCCTTGAATCACAACGAGACATGTACAAGTTCATCCACGACCAGGCGCTC
CGATTCGCGAACCAGGGTTACACGCCGCTCGAAGCTGCAGAGGTCGTGCGACTTCCGGAA
GCCATCGGCCAGAAGTGGTACAACCGTTACTACCACGGCGGACTACACCACAACGTGCGC
GCGGTTTTCCACAAGGAACTCGGTTTCTGGGACGGCGATCCTGCGACGATCTTGCCGTTG
TTGCCCGAAGATCACGCCAAGCGGCACGTCGACTTGATCGGGCGGGACAAGATACTTGCC
GAGGGCCGCAACGCCTTCGACGCGGGTGACTATCGTTGGGCTGTACAACTTCTGCATCAT
CTGGTCTTCGCGGACCCGGCTGACGACGAGGCGAAGAATCTACAAGCCGATGCCTACGAA
CAACTCGGGTATCAGCAGGAAGTACCGCAGTATCGGTCGATCTTCCTCGCCACTGCGATG
GAACTGCGGAACGGGGTGACCGGCGCCGGTCAGGTCAATACCGACAGCACCGACACGATT
CTGGCGATGCCGATCGATCTGCTCTTCGACTACGCGGGAGTACATCTCGTTGCGGAAAAG
GCCGATGACGTCGACATTTCCGTTAATTTCAGTTTTGCCGACACCAAGCAGGACTGGAAC
ATGTGGGTGCGTCGAGCGGTGCTGAACGCCCGCTCCGGACGTGCTCCCGACGCACAACTG
ACTCTCACCGGCCCGAAGGCGCTACTTGCCGGAATTCTGCTCCAACCAGGCAAAGCGTCC
GCCGTTCTCGACAGCGGGAAGGTCACGTACGACGGCGATGTCTCGACTCTGTCGCGTTTC
GCCGACATCATGGACGTGTTCGACCCGAATTTCAACATCGCGACACCGTGA