METABLE2 Genes

PROKKA_00002 Marinomonas

GenomeMarinomonas ctg_1:176-251
ProducttRNA tRNA-Val(tac)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00002 tRNA-Val(tac)
GGGTGTGTAGCTCAGTTGGGAGAGCGTCGCCCTTACAAGGCGAATGTCGGGAGTTCGAAC
CTCTCCACACCCACCA