METABLE2 Genes

PROKKA_00003 Marinomonas

GenomeMarinomonas ctg_1:316-392
ProducttRNA tRNA-Asp(gtc)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00003 tRNA-Asp(gtc)
GGAGTGGTAGTTCAGTTGGTTAGAATACCTGCCTGTCACGCAGGGGGTCGCGGGTTCGAG
TCCCGTCCATTCCGCCA