METABLE2 Genes

PROKKA_00004 Marinomonas

GenomeMarinomonas ctg_1:444-519
ProducttRNA tRNA-Val(tac)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00004 tRNA-Val(tac)
GGGTGTGTAGCTCAGTTGGGAGAGCGTCGCCCTTACAAGGCGAATGTCGGGAGTTCGAAC
CTCTCCACACCCACCA