METABLE2 Genes

PROKKA_00005 Marinomonas

GenomeMarinomonas ctg_1:565-640
ProducttRNA tRNA-Thr(tgt)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00005 tRNA-Thr(tgt)
GCCGCTATAGCTCAGTTGGTAGAGCATCTGACTTGTAATCAGAGGGTCCCGAGTTCGACT
CTTGGTGGCGGCACCA