METABLE2 Genes

PROKKA_00007 Marinomonas

GenomeMarinomonas ctg_1:802-877
ProducttRNA tRNA-Thr(tgt)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00007 tRNA-Thr(tgt)
GCCGCTATAGCTCAGTTGGTAGAGCATCTGACTTGTAATCAGAGGGTCCCGAGTTCGACT
CTTGGTGGCGGCACCA