METABLE2 Genes

PROKKA_00008 Marinomonas

GenomeMarinomonas ctg_1:947-1022
ProducttRNA tRNA-Thr(tgt)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00008 tRNA-Thr(tgt)
GCCGCTATAGCTCAGTTGGTAGAGCATCTGACTTGTAATCAGAGGGTCCCGAGTTCGACT
CTTGGTGGCGGCACCA