METABLE2 Genes

PROKKA_00009 Marinomonas

GenomeMarinomonas ctg_1:1036-1112
ProducttRNA tRNA-Pro(ggg)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00009 tRNA-Pro(ggg)
CGGGGCGTAGCGCAGCCTGGTAGCGCACTAGCATGGGGTGCTAGTGGTCGCAGGTTCAAA
TCCTGCCGTCCCGACCA