METABLE2 Genes

PROKKA_00017 Marinomonas

GenomeMarinomonas ctg_1:8644-9270
ProductCDS Putative O-methyltransferase/MSMEI_4947
Inferenceab initio prediction:Prodigal:2.6,similar to AA sequence:UniProtKB:A0R2D5
Sequence
>PROKKA_00017 Putative O-methyltransferase/MSMEI_4947
ATGGATCTCAATAATCTTGACGACTACTGCATTGAGACGACTCAAGCAGAACCTGACCTA
TTAGTTGAGCTGGTTGAAAAAACCTACTCTGATATGGGCTACCCAAATAAGTTATCAGGA
AAAACCATCGGCCGTACGCTGAAGCTTCTGGCAAAAATAGCACAACCCAAGCGCGCGTTA
GAAATTGGCATGTTTACTGGATATTCAGCATTGTCTATCGCAGAAGGCATGCCTGCAAGT
GGTGAGCTTATTTGTTGTGAAACCAATCCCAGAGCAATTGAATTCGCTCAGTCTTTTTTT
GATCGCAGCGAGCATGGTAAAAAAATCAAAGCGATTTTTGGACCCGCTCTCGATACGATC
GAATCCCTTGAAGGGGAATTCGACTTTGTCTTTATTGATGCCGATAAACGTAACTACCTA
AATTACTACGAAGCAGTACTACCGCTTGTTAGATCTGGTGGCCTTATCATTATTGATAAC
TCCCTATGGCAAGGAAGAGTTCTAGACCCGAAAGAAAACAGCGATATTGCTGTCAACCAA
GTCAACCGCCTAATCGCGCAAGACAATCGAGTTGAAAACGTTCATCTGAACGTTCGTGAC
GGTCTTAACATCGTCGTAAAACACTAA