METABLE2 Genes

PROKKA_00018 Marinomonas

GenomeMarinomonas ctg_1:9376-10077
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00018 hypothetical protein
TTGGTCGTTTTTAAAATCACAAATAACATCTCCGGCAAACACTACATTGGAACGTCTTTC
AATAGTGGCTTTCAACGTTTCGAACAATACGTAGAAGCAACTAGCGAAGGTTTAGACTTC
CCTTTATACAACGACATTAGGGAGAATGGCGTTGAAGCTTTTACAGTTGAAGAACTATTT
GAAACAAGCGACAAAGAAGAACTGTATGAATTAGAAACAGACTACATTTCTATTTATAAC
GGTGAGAGCTTACGCGGCTATAAGATTGCACAGACAGCGGAAAAAGCCACAAATCTAAAT
CTAGGCAAAAAAGCATTATTTGATGCGAATGGCGTATCGACAGCAGAACAGCCCAAGAAA
ACAAGAAAAGTAGCCACAAAAAAGACTGTTGAACTCCCAAAAAAAACACTTGAGCCAGCC
CCAACAACAAAATCATTCTTTGGCGAACTCATCGGTGAAGACAGATTAGGCACCCCACTC
GCTGCAGCAGCCACAGAAAAGAAAAAAGCACCAGCTCGCACCAAAAGCAAGGCCAGCATC
CAGAAGATGCTAAGCGAAGCTGAGAAAGCATCAAAAAAAGAACGTGAAGAAAAATTAAAA
TCACAGCAGCAAGCAGAAGCAGAAGAAATGGCTCTCATCATGGCAAAAATTGATGTGACA
TCCAAATCTGCCTCATCCGCATTTCGTCGCCGTAAAAGTTAA