METABLE2 Genes

PROKKA_00026 Marinomonas

GenomeMarinomonas ctg_1:15619-18324
ProductCDS preprotein translocase subunit SecA
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK13103
Sequence
>PROKKA_00026 preprotein translocase subunit SecA
ATGTTAGGAACTGTAATTAAAAAAATTGTCGGCACAAAGAATGACCGAGAAGTTAAACGA
TATAGAAAAGTCGTTGCACAGATAAACCAGCTTGAAGAATCTTTCCACAAATTATCTGAT
GATGATTTGTCAGGGAAAACAAGCGAGTTTCGTGATCGTCTCGCAAAGGGTGAGTCTTTA
GAATCTATTTTGCCTGAGGCTTTTGCGGTGGTACGAGAAGGCAGTAGCCGTGTTATGGGC
ATGCGTCATTTCGATGTGCAGCTCATTGGTGGCATGGTTCTTAATGAAGGTAAAATTGCT
GAAATGCGTACAGGTGAAGGGAAAACGCTTGTAGCAACACTGGCTGTTTACTTAAATGCT
TTGTCTTCCAAAGGTGTTCACGTTGTTACGGTGAATGATTATCTGGCTAAGCGTGATGCT
AACTGGATGCGACCTTTATATGAATTTTTAGACATGAGTGTTGGTGTGGTTTTCTCGGGT
CAAGATCGTGACGAGAAGAAAGCAGCATACTTGTGTGATATTACTTATGGTACCAATAAC
GAGTTCGGTTTTGACTATCTTCGCGACAATATGGTTTTTCGTTTAGAAGATCGTGTTCAG
CGTGATTTAAACTTCTCTGTAGTGGATGAAGTGGACTCCATTCTGATAGATGAGGCTAGA
ACGCCTCTCATTATCTCGGGTGCGGTTGAGGATAGCTCTGAGCAGTACCGTAAAATTAAT
CAACTTGCTCCTTTATTGGTTAAGCAGGAAGATATTGAAGGTGAAGAGCCAACAGGTCAT
TACGTTTTTGATGAGTCTCAGCGCAGTATTGAATTGACGGAAGATGGTCATTCTTTTGTT
GAGGATTGGCTGGTTGAGCAGGGTTTGTTGGGTGAGGGTGAAAGTCTTTATGCGGCTGGG
AACCTTTCTCTATTGCATCATGTTCATGCTTGTTTGAAAGCGCATGTTATTTTTAAGAAG
AATGTTGATTATGTGATTCAGGGAGACCAAATCGTCATTGTTGATGAGCATACAGGTCGA
ACTATGGCTGGTCGTCGTTGGTCTGAAGGTATTCATCAGGCGGTAGAAGCTAAAGAGGGT
GTGACTATTCAAGCAGAAAGTCAGACGTTGGCTTCGACAACTTTCCAGAATTACTTCCGT
TTATATGAAAAGCTATCTGGTATGACCGGTACAGCTGATACGGAAGCGTTTGAGTTTCAG
CAAATTTACGGGTTATCCGTTATTGTTATTCCTACAAACCGCCAGGTTCAGCGTAAAGAC
TTCAATGATTTAATTTATATGTCTACTGAAGACAAATTTGAAGCGATTGTGTTGGATATT
GAAGAGATTGTTAAGCAGGGTCGTCCAGTGTTGGTTGGTACTGCATCTATTGAATATTCA
GAGCTTTTATCAAATTACCTGCTTGAAAAAGACGTGAAGCATAATGTTCTTAATGCTAAG
CAGCATGAGCGTGAGGCTGAAATTGTTGCTGATGCTGGTCGACCTGGTGCGGTAACAATT
GCTACTAACATGGCCGGTCGTGGTACAGATATTGTATTGGGTGGTAATTTGCAAGTTGAG
TTAGCTCAACTAGGTGAAAATGCTAGCCAAGAAAGTATTGATGCGCTTAAGGCTGATTGG
AAGTCTCGTAATGAGTCAGTTTTGGCAGCAGGTGGTTTGCATATTATAGGTACTGAGCGT
CACGAGTCGCGTCGTATTGATAACCAGTTGCGTGGTCGTGCTGGCCGTCAAGGTGATGTT
GGTTCTTCACGCTTTTATTTGTCTTTAGAAGATAATCTAATGCGTATCTTCATGTCTGAT
CGTATCAAGAAAATGATGATGGCGCTTGGGATGGATAAGGGTGAGGCCATTGAGCATAAG
ATGGTTTCAAATGCGATTGAAAAAGCGCAGCGTAAAGTTGAAGGTCGTAACTTTGATATT
CGTAAGCAATTGCTTGAATATGATGATGTGGCAAACGATCAGCGCCAAGTAATTTATCGT
CAGCGTTTTGATATGATGGTATCTGAAGATCTCTCTGAAGCTATTTCTGCAATGCGAGAA
GAGGTTGTTACCAGTTTGATTGATGAATTTATTCCGCCTCAAAGTATCTTTGATATGTGG
GATCTTGAGGGATTGGAAGATAAGTCTCGTAATGAGTTTGGTCTGGAGCTGCCTGTTGCT
AAGTGGGTTGAAGAAGATAAGAAACTATATGAAGAGCCTCTGCGCCAGAAAATACTAGAT
ACATTTGTCAGTGATTATCAGGCTAAAGAAGAAATTGCTGGTGCGCAGTCATTTAGGGCT
TTTGAAAAACAAGTGCTATTACAGGTTCTTGATACTTTATGGAAAGAGCATCTTCAGACA
ATGGATATGCTTAGGCAAGGCATCCACTTACGTGGTTACGCACAAAAGAATCCTAAGCAG
GAATATAAGCGTGAGTCGTTTGAGTTATTTCAAGGTTTGCTAGAACAAATCAAATATGAA
GTGATTCAAATTATTACTCGTGTAAAAGTTCAGTCTGCTGAAGAGGCTGAGAAAATAGAA
GAAGCCCGTAGAAAGCAAGAAGAGAAAACGACTGTTAATATGATTCATGATTCATTGAAT
TCATTGGCTGAAGATTCTTTATTGTCTACAGATGGTGCTCAAGAGTTCCCTAAAGTGGGT
CGAAATGAGCCTTGCCCATGTGGTTCAGGTAAAAAATACAAACAGTGTCACGGTAGTCTT
ATTTAA