METABLE2 Genes

PROKKA_00040 Marinomonas

GenomeMarinomonas ctg_1:34447-34770
ProductCDS cell division protein FtsL
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK10772
Sequence
>PROKKA_00040 cell division protein FtsL
ATGTTCGCTCTCGTAGTGCTGTCTTGCGCGTTTTGGAGCGGGTCAGTGATTAAGGCTCGT
TTTTCACCGTTAGTATTTGCTATCGGTGTTGTTGTTTTAGCGATTGTTTCAATTGCTGTT
GTTATTCAGGTATACGATTTTAGGAAGGATTTCTCTTACCTTCAAACATTGAAGCAAGAT
GAAGTGGATTATGAAGTGAAATGGGGCCAGTTGCTTCTTGAACAAAGTGCGCTAACCCAG
CCAAGTCGCTTAGAGCAAGCGGCTATTAAAGATTTAAAAATGCACGCACCCTCTCAGGAT
GAATTGATAATAGTGAAACCATGA