METABLE2 Genes

PROKKA_00042 Marinomonas

GenomeMarinomonas ctg_1:35653-36108
ProductCDS cell division protein MraZ
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK00326
Sequence
>PROKKA_00042 cell division protein MraZ
ATGTTTCGTGGGATTCATCAGGTGAGTGTAGATGTGAAGGGGCGAATGTCGCTTCCGGCA
CGCTTACGCGATGATCTGGCCCAATATGATGACGATGGTGTGGTTGTGACCATTGATCCT
GTTTCTCGATGCTTGTTGCTCTATCCCTTATCTGAATGGGAATTGATTCAGCAAAAATTA
GATAAGTTGCCCACGTTTCAGCCACAAGCTAGGCGTTTGCAGCGTCTTTTAGTGGGGCAT
GCGACTGATTTGGAAGTGGATAAAGCGGGTCGGATTTTGTTGCCTGCGCCACTGCGTGAA
TTTGCTCGGTTGGATAAAAAGTTAACGATTCTTGGCCAAGGTAAGAAGTTAGAAATTTGG
AGCCAAGAAGAGTGGGAAGCGCAACGTGAAGATTATTTGTCCCAAGATGCTCTTGCGGAC
TTACAAACTGAAACCATGATGGATATTTCTTTATGA