METABLE2 Genes

PROKKA_00047 Marinomonas

GenomeMarinomonas ctg_1:41613-41810
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00047 hypothetical protein
ATGCAGGAATTGTTGCAGTCGCTGCTGGTTGGCGTCAGCCTTTTATTGATCGCCGAAGGT
GTTTTGCCTTTTCTCGCTCCAAATATATGGAGAGAAATAATGGTGAAAGCTATCGCGAGC
TCGGATTGGAATTTGCGTATTCTGGGCGCGGTTAGTATGTTTCTTGGATTAATGCTTCTT
TTGCTGACTCGAAGCTAA