METABLE2 Genes

PROKKA_00056 Marinomonas

GenomeMarinomonas ctg_1:50720-51469
ProductCDS Sulfite exporter TauE/SafE
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF01925.13
Sequence
>PROKKA_00056 Sulfite exporter TauE/SafE
ATGGACTGGCTCTTCATTTCACTCATTGCCATTGCCGTTTTCATTACAGGCATATCTAAA
GGTGGTTTTTCTGGTGCATTTGGCATTCTCGCTGTTCCGCTTATTTCACTGCAAACTTCA
CCTATGCTTGCAGCTGCTATTATGTTACCCATTCTGTGCATCATGGACATATTTACAGTG
CAAAAGTTCTGGAAAAAATGGAATACAGAGCAACTCATCAAATGCATTCCAGCCGCTATA
ATAGGCGTTGTTATTGGCGGACTCACTGCATCATGGTTTTCGGCAGAATGGTTGAAAATA
ATGGTAGGTATTATTGCGGTAGGCTTCACCCTAAACTCATGGCCAAAAAAGAGCCGGACA
GCACAACAAAAACCGCTTAGTACTCTTGCAGGAAAATTCTGGTGTGCACTTGGCGGCTTT
ACAAGCTTTATTGCTCACGCTGGCGGGCCACCAATGAGCGTTTATTTACTTAGGGCAAAT
CTAGATAAGACACAATACGTAGCGACTGCAGCCGTTATTTTCACCGCCATCAACTATGTA
AAACTCATCCCATACGGGATGCTTGGGCAACTTAATAGTTCAAATATACTTCTGTCACTT
TGCTTCACACCGGTAGCTTTTTTAGGCGTGCAACTTGGTGCTTGGTTACACTACAAAATA
TCTACCGCATTATTCTTCAAGGCCATGTACAGCTTTCTTTTCTTGACAGGAATAAAACTA
ATATGGGATGGGATAGCAGGAATAAGTTAA