METABLE2 Genes

PROKKA_00061 Marinomonas

GenomeMarinomonas ctg_1:55161-56639
ProductCDS HDOD domain protein
Inferenceab initio prediction:Prodigal:2.6,protein motif:Pfam:PF08668.6
Sequence
>PROKKA_00061 HDOD domain protein
ATGATAGACAAGTCACCTTCTGGCCTAAATGAATGGCTACATTTTCTTAAAAATAAAAAA
TTTCCTGTTAGAGCAGTTAATTTAGCTCGCCTAAAAACTCAAATTAAAAGAACAGAAGAC
ACTCTTGATGGAATGCAAGCAAATATAGCCTCAGACCCACTGCTAGCTTTCGCTATTCTA
AATGAAGCAAATCGCATCATACCGAATAAAAACAATGAAATAAAAACGCCTTTTCATGCT
GCTGCCATGGTGGGAATGAACGGCATTGCAAAACTACTTTCACACTTTGCCCCCTACGAG
CTCAACACCCAAAAAAAACCTCCACATTTAGTTGCCTTTTTAAGCGAGATACAAACCAGC
TATGAAGCAGCAACCATTGCCAGACACTGGTCAATTGAAAAACTAACCAGCCAAGAAGAT
GATATTTTCTGGATAACACTATTTCGAGATTCTGCAAGGTGGCTATTGTGGTTCTATGCC
TACCCAACCATGGCAGCCCTAAAGCAAAGAATACAGCAAGGCGAAAAAGCCAGCCAAGCC
GAGCTAAACATTTTGGGGTGTCGCATAGATGAGCTCACCGTCCATCTATGCAACCATTGG
CACACACCAAACAAAGTCATAGAATCATTTTTAACCAAGCACATACCGAACGCAAAGGAG
CTACAAGCACTGGCACATCTAGCAAACCATCCAGACGAGCTACCTGGTTTCACCGAAGAT
AAAAGACTGACCATTTTAGTAAATAATCCACTTATTTTTTCGTACTGCGCAAACAAGGTT
GCCCATGAAGCCAGCCTAATGCGATGGGACTCCAAAAACCTGCCATTTTTCTATCGCGTT
GTTGCCACGGTAATGCACAAGCGACTGAGCGACATCATCAAAACAGCACACTTCGCAAGC
ACTGAAGCCGCAACCTTATTTAACAACGGCGGAAAAATCCCACTTGCGCAACAATTACTT
GATCCTGATTTATATTTAGGCAAAACAAGATCAAAACCTAAAACATCTTTATCCCCTATT
GCAGCACTCAAAAAAGCACTCAAGCAAAATAAAGAATACGACACAAAACAAAAAACAGGA
CTTGCTCTAAAAACCATCAAGCAAGCTATACCAAATGCACAACACAGCATTATTTTTAAA
CACTCAAATAACAAAACCGCCCCCATGTACCAATTTGGCTACAATATAGATATCATCAAA
GCCATCCAATGGAGCGCACCATCAAGCGTGTTTAAAAAACTGTCCGACAAACGCTCTGCC
ATTCACATATTTGGACAAAAACTTGATAATTTACTAAAAGATTTACCACACACATCTGAT
CAAATAATTGACGCAAATAGCCACCTTATTCTGGCATCAACACAAACCTCAAAAGATGAA
ACAGCGATATTTTGGTTAGAAACCCGCACCGAATTCAACGAAATAGATTATAAAAACCTA
AAACAGATCGTGTCTTTAATCAGCCACAACATACTATAA