METABLE2 Genes

PROKKA_00063 Marinomonas

GenomeMarinomonas ctg_1:57598-58512
ProductCDS preprotein translocase subunit SecF
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK13022
Sequence
>PROKKA_00063 preprotein translocase subunit SecF
ATGAAAGTGACAAATATTCCGTTTATGGCAATGCGTAAGATCGTAGCTGTCTTTTCGCTT
ACGCTGATACTCATCTCTCTTGGCTCTTTGGCAACAAAGGGACTACAGTTTGGGTTGGAT
TTTACTGGTGGTACATTGATTGAGGTGTCTTATAAAGAGGCGCCACAGTTAGATGATGTA
CGTACGCTACTGGGTGATAATGGCTACTCTGATGTCGTTGTGCAGAACTTTGGTTCGCCA
ACTGATGTTGTGGTTCGTATGGCAAATTCCTACACAGCGACCCTTGGTGATGAAGTGTTA
TCTACACTTCAAAATAATGGGACGACTGATGTATCTCTACAGCGCTCTGAGTTTGTGGGT
GCGCAAGTAGGTGAGGAATTACGTGAGCAGGGTGGTCTGGGTATGTTGCTTGCCTTGGCC
ATTGTGATGATTTACGTAGCTGTGCGTTTCCAGTTTAAGTTCTCTGTGGCATCCGTTGCG
GCTTTGATTCACGACGTAATTATCACGTTAGGGTTCTTTTCTATCTTCGAGGTAGAGTTT
GATCTTACAGTACTGGCAGCGTTGCTTGCTGTGGTCGGTTACTCTCTGAACGATACGATA
GTGGTGTGTGACCGAATTCGTGAGAATTTCCGTATTATGCGCGATACGAAGCCCTATGAT
TTGGTGAATGATTCTATCAATCAGACGCTTGATCGTACTTTGATAACATCATTAACAACG
TTGTTTGTGTTGGTTGTTTTGTTTGTTATGGGCGGCGAAGCTATTCACAATTTCTCTATG
GCGTTGTTGGTAGGGATTGTGATTGGTACTTATTCTTCTATCTTCGTGGCAGCAAATTTA
CTACTAGCGATGGATGTTAAGCGAGAGGATTTAATCCCCGCGCCAAAGGCGGAATTGGAA
GACGATCTGCCTTAG