METABLE2 Genes

PROKKA_00064 Marinomonas

GenomeMarinomonas ctg_1:58522-60372
ProductCDS preprotein translocase subunit SecD
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK12933
Sequence
>PROKKA_00064 preprotein translocase subunit SecD
ATGCTTAACAAGTATCCCTTGTGGAAGTATTTGCTAATTCTTCTTGTTTTGGCTTTGGGG
CTACTGTATGCCTTCCCAAACCTTTATCCGGATGATCCAGCGCTACAACTATCTACCCAA
AAAGCGACTGCTGTTGTTGATGAGCAGGCTTTGCAAAAAGCGAAAAGTGCGCTTTCAAAA
GCGAATATAGATTTAAAAGAAGCAGAGCTTACCTCTGCTGGCGGTACCTTACGCTTTAAT
AGCGGTGAGGACCAACTTGCTGCTAAGCCGGTTGTGGCGGCAGCACTGGGTGATGATTAT
GTAACTGCGCTTAACCTTGTTCCTACGACGCCGGAATGGTTGTCTTCCTTAGGTGCTGGC
CCTGCGAAGCTAGGTCTTGATTTGCGTGGTGGTGTGCATTTCTTGTTAGAAGTGGATACG
CCTGCAGCGTTAAAGCAAAAGCTTGAAGTTAGCGCTAGTGAAATGAAGGCGGCATTGCGA
AAAGATCGTGTGCGTTATCGCAGTGTTGATATTGAAGACGGTGTGCTTTCGATTCGCTTC
TTGCAGCAGCCTGACTTGGCCACGGCAGAAACCTTGCTGAAGAAAGATTTTTCTGAGTAC
CGCTATGCTACTCGTGAAGATGGCAGTGATTTTTACTTAGATGTGAGTTTTACTGAAGCT
GCTAAGAAAGAAATCGAATCTTATGCGCTACAGCAAAACTTAACGACATTGCGAAACCGT
GTAAATGAACTAGGTGTTGCTGAGCCTTTGGTTCAGCGTCAAGGCAGTAACCGTATTGTT
GTCGAGCTGCCTGGTGTTCAGGATACTGCGGCAGCGAAACGCATTATCGGTGCAACAGCC
AACCTTGAGTTCCATTTGGAAGCGGGTCTGGAGGACAAAGGTGCAGACATTGAAACCTTG
TCTTTCCGTGATGGCAGTGGTCGCACAGCGCGTCTAGAGCGTGATCTTATTATCACTGGT
GACAGTGTTTCTGATGCAAGTTCTTCTTTTGATGAAAACGGTCGCCCACAGGTAAACATT
AGTTTGGATGCCAAAGGTGGTAAGCAGATGAGTAAAGTGACTCGTTCTGCTGTTGGTCGA
AATATGGGTGTTGTGTTTATCGAGCATAAGTCTCGTAGTCGTTTTGTCGAGAAAGACGGC
AAAATGGAAGAAGTGCGTAGAAGTTACAGTGAGAAAGGCATCATTTCTTTGGCGACAATT
CAAACGACGCTGGGGAATTCATTCCGTATTACGGGTCTAGACAGTCCTCGTGAGTCTTCT
GAGTTGGCTTTGTTGCTTCGTGCTGGTGCCTTGGCTGCGCCAATTTACTTTGTTGAAGAG
CGTACCATTGGGCCTAGTTTGGGTGCAGAGAACATTAAATTAGGTGTTGATTCTGCCCAA
ATTGGTTTGTTGGTTGTTATGGTGTTTATGCTGCTTTATTACAAGGTGTTTGGTCTTTTT
GCCAATATCTCGTTAGCATTAAATATTGTGTTGCTGATGGCGTGTATGTCTTTGCTTTCC
GCTACGCTTACCTTGCCAGGTATAGCTGGTATTGTATTGACGATGGGGATGGCGGTGGAT
GCAAACGTGTTGATTTTCTCGAGGATAAAAGAGGAATTAGCAAGTGGAGTGCCGAATCAG
CAAGCGATTCACTCTGGTTTTAACCGCGCATTTACGACTATTTTTGATGCCAATATCACC
ACTTTGTTGGTTGCTGTGATTTTGTTCGCGGTAGGAACTGGGCCTGTTAAAGGTTTCGCA
GTGACATTGTCGCTGGGTATTCTTACTTCTATGTTTACGGCAATCGTTGTAACTCGTGCA
CAGGTTAATCTTGTGTATGGTGGTCGTAAAAACAAGAAACTGTACATTTAG