METABLE2 Genes

PROKKA_00065 Marinomonas

GenomeMarinomonas ctg_1:60451-60777
ProductCDS preprotein translocase subunit YajC
Inferenceab initio prediction:Prodigal:2.6,protein motif:CLUSTERS:PRK05585
Sequence
>PROKKA_00065 preprotein translocase subunit YajC
ATGATCGCATTGATCTCACCAGCTTACGCTGAAGGCGGCGCAGCAGCAGATACAGGTATT
TTTAACCTAGTGCTTCTTGCAGGCTTCGTTGTCATTTTTTACTTCCTTATGTGGCGCCCA
CAAGCGAAACGTGCAAAAGAGCATAAAAACTTGATTGCATCTCTAGCGAAAGGTACTGAG
GTAGTAACTGGCGGTGGTGTACTAGGTAAAGTGTCTAAAGTAGACGATAACTATGTAGTA
CTTGAAGTATCTGAAGGCATCGAAATGAAGTTTCAAAAGTCTTCAGTTGCTGCTGTTTTG
CCTAAGGGAACGTTAAAGTCAATTTAA