METABLE2 Genes

PROKKA_00068 Marinomonas

GenomeMarinomonas ctg_1:63221-63305
ProducttRNA tRNA-Leu(caa)
InferenceCOORDINATES:profile:Aragorn:1.2
Sequence
>PROKKA_00068 tRNA-Leu(caa)
GCCAGTGTGGTGGAATTGGTAGACACGACGGATTCAAAATCCGTTGCCTTCGGGTGTGGC
GGTTCGAGTCCGCCTACTGGTACCA