METABLE2 Genes

PROKKA_00069 Marinomonas

GenomeMarinomonas ctg_1:63394-63591
ProductCDS hypothetical protein
Inferenceab initio prediction:Prodigal:2.6
Sequence
>PROKKA_00069 hypothetical protein
ATGAATCGCCGCAAAAAAATCAAAGACATTTATGATAAGCGTATGAAGCAAGCTAACTTA
AAGGTTAACCCTAAAAAGGCTAAGCCTAAGTACATTTCTAAAGCTGAGCGCGCAAAAATG
GAAGCAGAAGCTGCTGCAAATCCAAGCACGCATGTTGACGCAGAAGCCTCTGAAACAAGC
GAAACAAAAGACGCTTAA